Review



double-stranded transcription factor of gata consensus oligonucleotide  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Santa Cruz Biotechnology double-stranded transcription factor of gata consensus oligonucleotide
    Double Stranded Transcription Factor Of Gata Consensus Oligonucleotide, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/consensus+oligonucleotides/double+stranded+transcription+factor+gata+consensus+oligonucleotide/pmc11921293__atm___13___01___e3___supplementary-95-7-10
    Average 90 stars, based on 1 article reviews
    double-stranded transcription factor of gata consensus oligonucleotide - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: SiRNA targeting ETS1 and ELK1 and method of using same in the inhibition of CIP2A gene in cancer treatment
    Article Snippet: The wild-type and the mutant probes were synthesized as double stranded oligonucleotides (Integrated DNA technology) from the −138 to −107 region of the CIP2A gene promoter. .. Consensus oligonucleotides for Ets1 and Elk1 were synthesized based on the sequence data from Santa Cruz Biotechnology (Santa Cruz, Calif.) and Panomics (Affymetrix, Calif.). ..

    Article Title: Ets1 and Elk1 transcription factors regulate cancerous inhibitor of protein phosphatase 2A expression in cervical and endometrial carcinoma cells.
    Article Snippet: The wild type and mutant probes were synthesized as double stranded oligonucleotides (Integrated DNA technology) from the −138 to −107 region of the CIP2A gene promoter. .. Consensus oligonucleotides for Ets1 and Elk1 were synthesized based on the sequence data from Santa Cruz Biotechnology (Santa Cruz, CA) and Panomics (Affymetrix, CA). ..

    Sequencing:

    Article Title: SiRNA targeting ETS1 and ELK1 and method of using same in the inhibition of CIP2A gene in cancer treatment
    Article Snippet: The wild-type and the mutant probes were synthesized as double stranded oligonucleotides (Integrated DNA technology) from the −138 to −107 region of the CIP2A gene promoter. .. Consensus oligonucleotides for Ets1 and Elk1 were synthesized based on the sequence data from Santa Cruz Biotechnology (Santa Cruz, Calif.) and Panomics (Affymetrix, Calif.). ..

    Article Title: Ets1 and Elk1 transcription factors regulate cancerous inhibitor of protein phosphatase 2A expression in cervical and endometrial carcinoma cells.
    Article Snippet: The wild type and mutant probes were synthesized as double stranded oligonucleotides (Integrated DNA technology) from the −138 to −107 region of the CIP2A gene promoter. .. Consensus oligonucleotides for Ets1 and Elk1 were synthesized based on the sequence data from Santa Cruz Biotechnology (Santa Cruz, CA) and Panomics (Affymetrix, CA). ..

    other:

    Article Title: Pleiotropic functions of pituitary adenylyl cyclase-activating polypeptide on retinal ontogenesis: involvement of KLF4 in the control of progenitor cell proliferation.
    Article Snippet: We showed previously that the neuropeptide pituitary adenylyl cyclase-activating polypeptide (PACAP) negatively regulates proliferation of postnatal rat retinal progenitor cells through the downregulation of cyclin D1 in a cAMP/protein kinase A dependent manner.. In the present study, we describe by microarray analysis several putative PACAP targets regulated by different transcription factor families.. One of these families is the Sp/Klf family of transcriptional factors capable of regulating cyclin D1, and among members, we demonstrate by immunocytochemistry that KLF4 is expressed throughout rat retinal development by retinal progenitor cells and in most differentiated cell types.

    Article Title: Toll-Like Receptor Stimulation Induces Nondefensin Protein Expression and Reverses Antibiotic-Induced Gut Defense Impairment
    Article Snippet: The consensus and control oligonucleotides (Santa Cruz Biotechnology Inc.) were labeled by polynucleotide kinase; the NF-κB consensus sequence was 5′AGTTGAGGGGACTTTCCCAGGC3′ (1.75 pmol/liter).

    Article Title: Molecular regulation of the expression of leptin by hypoxia in human coronary artery smooth muscle cells.
    Article Snippet: Consensus and control oligonucleotides (Santa Cruz Biotechnology Inc., CA) were labeled by polynucleotides kinase incorporation of [γ-32P].

    Article Title: Mechanism of the inhibitory effect of atorvastatin on leptin expression induced by angiotensin II in cultured human coronary artery smooth muscle cells
    Article Snippet: Leptin contributes to the pathogenesis of atherosclerosis.. Ang II (angiotensin II), a proatherogenic cytokine, increases leptin synthesis in cultured adipocytes.. Statin suppresses leptin expression in adipocytes and human coronary artery endothelial cells.

    Electrophoretic Mobility Shift Assay:

    Article Title: AEE788 is a vascular endothelial growth factor receptor tyrosine kinase inhibitor with antiproliferative and proapoptotic effects in acute myeloid leukemia.
    Article Snippet: AEE788 is a vascular endothelial growth factor receptor tyrosine kinase inhibitor with antiproliferative and proapoptotic effects in acute myeloid leukemia Nuria Barbarroja, Luis-Arı́stides Torres, Antonio Rodriguez-Ariza, Araceli Valverde-Estepa, Laura Maria Lopez-Sanchez, Patricia Ruiz-Limon, Carlos Perez-Sanchez, Rosario Maria Carretero, Francisco Velasco, and Chary López-Pedrera Laboratorio de Investigaciones Biomédicas, Fundación IMABIS, Hospital Universitario Virgen de la Victoria, Málaga, Spain; Unidad de Investigación, Hospital Universitario Reina Sofı́a, IMIBIC, Córdoba, Spain; Servicio de Hematologı́a, Hospital Universitario Reina Sofı́a, Córdoba, Spain

    Binding Assay:

    Article Title: AEE788 is a vascular endothelial growth factor receptor tyrosine kinase inhibitor with antiproliferative and proapoptotic effects in acute myeloid leukemia.
    Article Snippet: AEE788 is a vascular endothelial growth factor receptor tyrosine kinase inhibitor with antiproliferative and proapoptotic effects in acute myeloid leukemia Nuria Barbarroja, Luis-Arı́stides Torres, Antonio Rodriguez-Ariza, Araceli Valverde-Estepa, Laura Maria Lopez-Sanchez, Patricia Ruiz-Limon, Carlos Perez-Sanchez, Rosario Maria Carretero, Francisco Velasco, and Chary López-Pedrera Laboratorio de Investigaciones Biomédicas, Fundación IMABIS, Hospital Universitario Virgen de la Victoria, Málaga, Spain; Unidad de Investigación, Hospital Universitario Reina Sofı́a, IMIBIC, Córdoba, Spain; Servicio de Hematologı́a, Hospital Universitario Reina Sofı́a, Córdoba, Spain

    Activity Assay:

    Article Title: AEE788 is a vascular endothelial growth factor receptor tyrosine kinase inhibitor with antiproliferative and proapoptotic effects in acute myeloid leukemia.
    Article Snippet: AEE788 is a vascular endothelial growth factor receptor tyrosine kinase inhibitor with antiproliferative and proapoptotic effects in acute myeloid leukemia Nuria Barbarroja, Luis-Arı́stides Torres, Antonio Rodriguez-Ariza, Araceli Valverde-Estepa, Laura Maria Lopez-Sanchez, Patricia Ruiz-Limon, Carlos Perez-Sanchez, Rosario Maria Carretero, Francisco Velasco, and Chary López-Pedrera Laboratorio de Investigaciones Biomédicas, Fundación IMABIS, Hospital Universitario Virgen de la Victoria, Málaga, Spain; Unidad de Investigación, Hospital Universitario Reina Sofı́a, IMIBIC, Córdoba, Spain; Servicio de Hematologı́a, Hospital Universitario Reina Sofı́a, Córdoba, Spain

    Mutagenesis:

    Article Title: Activation of NF- B by the Kaposi's Sarcoma-Associated Herpesvirus K15 Protein Involves Recruitment of the NF- B-Inducing Kinase, I B Kinases, and Phosphorylation of p65
    Article Snippet: .. Oligonucleotide probes were prepared as follows: 2μl NF-223 κB wild type or mutant consensus oligonucleotides (Santa Cruz), 3 μl of 10x PNK buffer, 2 μl 224 T4-PNK (NEB), 4μl γ32P-ATP (222 TBq/mMol) and 19 μl distilled water were mixed and 225 incubated for 1 h at 37°C. .. 226 The labelled ds-oligos were purified using the ProbeQuant G-50 Micro Colums (GE Healthcare) 227 according to the manufacturer’s instructions and diluted to 20.000 cpm/μl.

    Incubation:

    Article Title: Activation of NF- B by the Kaposi's Sarcoma-Associated Herpesvirus K15 Protein Involves Recruitment of the NF- B-Inducing Kinase, I B Kinases, and Phosphorylation of p65
    Article Snippet: .. Oligonucleotide probes were prepared as follows: 2μl NF-223 κB wild type or mutant consensus oligonucleotides (Santa Cruz), 3 μl of 10x PNK buffer, 2 μl 224 T4-PNK (NEB), 4μl γ32P-ATP (222 TBq/mMol) and 19 μl distilled water were mixed and 225 incubated for 1 h at 37°C. .. 226 The labelled ds-oligos were purified using the ProbeQuant G-50 Micro Colums (GE Healthcare) 227 according to the manufacturer’s instructions and diluted to 20.000 cpm/μl.



    Similar Products

    98
    LI-COR irdye intrared dye end labeled nf κb consensus oligonucleotide
    Irdye Intrared Dye End Labeled Nf κb Consensus Oligonucleotide, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/consensus+oligonucleotides/NFkB+IRDYE+700+OLIGOS/pm41291151-314-26-17
    Average 98 stars, based on 1 article reviews
    irdye intrared dye end labeled nf κb consensus oligonucleotide - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology double-stranded transcription factor of gata consensus oligonucleotide
    Double Stranded Transcription Factor Of Gata Consensus Oligonucleotide, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/consensus+oligonucleotides/double+stranded+transcription+factor+gata+consensus+oligonucleotide/pmc11921293__atm___13___01___e3___supplementary-95-7-10
    Average 90 stars, based on 1 article reviews
    double-stranded transcription factor of gata consensus oligonucleotide - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Beyotime biotin-labeled nf-b consensus oligonucleotide gs056
    Biotin Labeled Nf B Consensus Oligonucleotide Gs056, supplied by Beyotime, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/consensus+oligonucleotides/biotin+labeled+nf+%CE%BAb+probe/pm39910816-226-0-6
    Average 90 stars, based on 1 article reviews
    biotin-labeled nf-b consensus oligonucleotide gs056 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Beyotime biotin-labeled nf-kb consensus oligonucleotide gs056
    Biotin Labeled Nf Kb Consensus Oligonucleotide Gs056, supplied by Beyotime, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/consensus+oligonucleotides/biotin+labeled+nf+%CE%BAb+probe/pmc11997474__mmc2-259-0-5
    Average 90 stars, based on 1 article reviews
    biotin-labeled nf-kb consensus oligonucleotide gs056 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Beyotime biotin-labeled nf-κb consensus oligonucleotide gs056
    Biotin Labeled Nf κb Consensus Oligonucleotide Gs056, supplied by Beyotime, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/consensus+oligonucleotides/biotin+labeled+nf+%CE%BAb+probe/pmc11997474-265-0-5
    Average 90 stars, based on 1 article reviews
    biotin-labeled nf-κb consensus oligonucleotide gs056 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    98
    LI-COR irdye 700 stat3 consensus oligonucleotide
    Irdye 700 Stat3 Consensus Oligonucleotide, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/consensus+oligonucleotides/STAT3+IRDYE+700+OLIGOS/pm39777574-53-0-10
    Average 98 stars, based on 1 article reviews
    irdye 700 stat3 consensus oligonucleotide - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    90
    Sangon Biotech oligonucleotides containing consensus signature sequence derived mep2 promoter dna fragment
    Oligonucleotides Containing Consensus Signature Sequence Derived Mep2 Promoter Dna Fragment, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/consensus+oligonucleotides/oligonucleotides+containing+consensus+signature+sequence+derived+mep2+promoter+dna+fragment/pm39756762-61-11-21
    Average 90 stars, based on 1 article reviews
    oligonucleotides containing consensus signature sequence derived mep2 promoter dna fragment - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Sangon Biotech commercially synthesized oligonucleotides containing the consensus signature sequence derived from mep2 promoter dna fragment (5′-tgctcacgcatcg-3′)
    Commercially Synthesized Oligonucleotides Containing The Consensus Signature Sequence Derived From Mep2 Promoter Dna Fragment (5′ Tgctcacgcatcg 3′), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/consensus+oligonucleotides/oligonucleotides+containing+consensus+signature+sequence+derived+mep2+promoter+dna+fragment/pm39756762-61-3-21
    Average 90 stars, based on 1 article reviews
    commercially synthesized oligonucleotides containing the consensus signature sequence derived from mep2 promoter dna fragment (5′-tgctcacgcatcg-3′) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results